View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7910_high_4 (Length: 214)
Name: NF7910_high_4
Description: NF7910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7910_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 8e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 8e-57
Query Start/End: Original strand, 33 - 173
Target Start/End: Complemental strand, 43238744 - 43238605
Alignment:
| Q |
33 |
atggttttatgagctgagaaatctatnnnnnnnntatataatgaaaatgaaaatgcaatcaaggtgtgtcagaagatacaaacagctgaaaaacgaggaa |
132 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43238744 |
atggttttatgagctgagaaatctataaaaaaa-tatataatgaaaatgaaaatgcaatcaaggtgtgtcagaagatacaaacagctgaaaaacgaggaa |
43238646 |
T |
 |
| Q |
133 |
acgtcttcttctataatgcttaattaattaattttttattt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43238645 |
acgtcttcttctataatgcttaattaattaattttttattt |
43238605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 94 - 170
Target Start/End: Complemental strand, 25415846 - 25415771
Alignment:
| Q |
94 |
aggtgtgtcagaagatacaaacagctgaaaaacgaggaaacgtcttcttctataatgcttaattaattaatttttta |
170 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||||||||||||||||||| || | |||| ||||||||| |||| |
|
|
| T |
25415846 |
aggtgtgtaagaagtcacaagcagctgaaaaacgaggaaacgtcttcttctacaaagtttaa-taattaattattta |
25415771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University