View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7911_high_8 (Length: 231)

Name: NF7911_high_8
Description: NF7911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7911_high_8
NF7911_high_8
[»] chr1 (1 HSPs)
chr1 (15-182)||(28022620-28022787)


Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 28022620 - 28022787
Alignment:
15 agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaagacgagttggaggtgggagtacacaggcaaaatctctgg 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
28022620 agaacctgtggtagaaatatcggtatcagaacttgtttttgatcttaaaagcaaaatcgaaaacgagttggaggtgggagtacacaggcaaaatctctgg 28022719  T
115 tacaagggtatagagttggataatgagaaaaggattggattctatgctttgtgcggagatgaaacaga 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
28022720 tacaagggtatagagttggataatgagaaaaggattggattctatgctttgcgcggagatgaaacaga 28022787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University