View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7911_low_13 (Length: 228)
Name: NF7911_low_13
Description: NF7911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7911_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 32805134 - 32804942
Alignment:
| Q |
19 |
taaactgaggttaaacattagctagtagctacttctgacacaaccatttaccctttttatgatctgggaactagagaaagaaaccactgtatgttagggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
32805134 |
taaactgaggttaaacattagctagtagctacttctgacacaaccatttaccctttttatgatctgggaactagagaaagaatccactgcatgttagggt |
32805035 |
T |
|
| Q |
119 |
ttctcaacacaaactttttctgcatttggagtaacttattctacttgttttgagagacttcttctactacttcttcttcctcccacgttttct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
32805034 |
ttctcaacacaaactttttctgcatttggagtaacttattctacttgttttgagagactacttctactacttcttcttcatcccacgttttct |
32804942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 44 - 148
Target Start/End: Complemental strand, 32801913 - 32801809
Alignment:
| Q |
44 |
tagctacttctgacacaaccatttaccctttttatgatctgggaactagagaaagaaaccactgtatgttagggtttctcaacacaaactttttctgcat |
143 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32801913 |
tagcttcttctgacacatccatttaacctttttatgatctgggaactagagaaagaaaccactgcatgttagggtttctcaacacaaactttttctgcat |
32801814 |
T |
|
| Q |
144 |
ttgga |
148 |
Q |
| |
|
||||| |
|
|
| T |
32801813 |
ttgga |
32801809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University