View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7911_low_14 (Length: 226)
Name: NF7911_low_14
Description: NF7911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7911_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 4188010 - 4188217
Alignment:
| Q |
1 |
atagagggttggtgtcggtttaactttgttgataatgatatagccttcctctgataggtggcactactactagtggtagtgcatagaatatgcattgcnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4188010 |
atagagggttggtgtcggtttaactttgttgataatgatatagccttcctctgataggtggcactactactagtggtagtgcatagaatatgcattgcaa |
4188109 |
T |
|
| Q |
101 |
nnnnngtgctttgaacacattattatgttaagctatgcaaatcaatggattaagatctttccaaaatcgcatttaattcgctaatcattcacagtagtag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
4188110 |
aaaaagtgctttgaacacattattatgttaagctatgcaaatcaatggattaagatctttccaaaatctcatttaattcgctaatcattcacagtaggag |
4188209 |
T |
|
| Q |
201 |
gaaaacaa |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
4188210 |
gaaaacaa |
4188217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University