View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7912_high_12 (Length: 290)
Name: NF7912_high_12
Description: NF7912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7912_high_12 |
 |  |
|
| [»] scaffold0489 (1 HSPs) |
 |  |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0489 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: scaffold0489
Description:
Target: scaffold0489; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 271
Target Start/End: Complemental strand, 9872 - 9621
Alignment:
| Q |
20 |
agcacaacacaagatcatcatggccttaactcatccaaatctgattatgcttctcgatttaggtcatctcatgaaggaaacaacagcttcaacttgaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9872 |
agcacaacacaagatcatcatggccttaactcatccaaatctgattatgcttctcgatttaggtcatctcatgaaggaaacaacagcttcaacttgaaca |
9773 |
T |
 |
| Q |
120 |
caaaagagggtctcttcttccaccaagaggaaaggattaatattaaagcaaacatggaaacgcatgttcctcttactttgcttgaaaaatggctttttga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9772 |
caaaagagggtctcttcttccaccaagaggaaaggattaatattaaagcaaacatggaaacgcatgttcctcttactttgcttgaaaaatggctttttga |
9673 |
T |
 |
| Q |
220 |
agatgggggagcaagtcatgagtgccatgaagagcttataaacatgtcattg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9672 |
agatgggggagcaagtcatgagtgccatgaagagcttataaacatgtcattg |
9621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 271
Target Start/End: Original strand, 11156 - 11407
Alignment:
| Q |
20 |
agcacaacacaagatcatcatggccttaactcatccaaatctgattatgcttctcgatttaggtcatctcatgaaggaaacaacagcttcaacttgaaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11156 |
agcacaacacaagatcatcatggccttaactcatccaaatctgattatgcttctcgatttaggtcatctcatgaaggaaacaacagcttcaacttgaaca |
11255 |
T |
 |
| Q |
120 |
caaaagagggtctcttcttccaccaagaggaaaggattaatattaaagcaaacatggaaacgcatgttcctcttactttgcttgaaaaatggctttttga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11256 |
caaaagagggtctcttcttccaccaagaggaaaggattaatattaaagcaaacatggaaacgcatgttcctcttactttgcttgaaaaatggctttttga |
11355 |
T |
 |
| Q |
220 |
agatgggggagcaagtcatgagtgccatgaagagcttataaacatgtcattg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11356 |
agatgggggagcaagtcatgagtgccatgaagagcttataaacatgtcattg |
11407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University