View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7912_high_15 (Length: 247)
Name: NF7912_high_15
Description: NF7912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7912_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 10 - 234
Target Start/End: Original strand, 29257348 - 29257567
Alignment:
| Q |
10 |
tttttgtttcctaaaatactaactcaatatcaaatgtaaataggaggtttacgggttaaaaaggatagaaaaatgagaggaggagaggagatctgtaaaa |
109 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29257348 |
tttttgtttcctaaaatactgactcaatatcaaatgtaaataggaggtttacgggttaaaaaggatagaaaaatgagaggaggaaaggagatctgtaaaa |
29257447 |
T |
 |
| Q |
110 |
gctagcaagcaatctggtaaaccactttactttactttctgtaatttcaatacttctgaattattannnnnnnngtagaatgtactatatagttgagttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
29257448 |
gctagcaagcaatctggtaaaccactttactttactttctgtaatttcaatgcttctg-attatt----tttttgtagaatgtactatatagttgagttt |
29257542 |
T |
 |
| Q |
210 |
gatttttgattttgtggaatttgat |
234 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29257543 |
gatttttgattttgtggaatttgat |
29257567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University