View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7912_high_7 (Length: 401)
Name: NF7912_high_7
Description: NF7912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7912_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 1 - 382
Target Start/End: Original strand, 11312741 - 11313122
Alignment:
| Q |
1 |
gcggtttagtaagcatagcaacacgaaaagtttcatagcttggtccaagtccataagcaaattgaaacactttgtcttggtctgaaaccgtttcttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
11312741 |
gcggtttagtaagcatagcaacacgaaaagtttcatagcttggtccaagtccataagcaaattgaaacactttgtcttggtcagaaaccggttcttttat |
11312840 |
T |
 |
| Q |
101 |
agcagcaagattgtcacaaattgatttgaattcgcgtagatattcttcaagggttcgtgacccctttttgattgtcatcaacatgttcttcaaacttcgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11312841 |
agcagcaagattgtcacaaattgatttgaattcgcgtagatattcttcaagggttcgtgacccctttttgattgtcatcaacatgttcttcaaacttcgt |
11312940 |
T |
 |
| Q |
201 |
gccttctctatcgtggctggaagtagatgttctttaacgaaggtccagatctcatacgcagtgtcaccattgatcatggtcaatacttcttccttcatgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11312941 |
gccttctctatcgtggctggaagtagctgttctttaacggaggtccagatctcatacgcagtgtcaccattgatcatggtcaacacttcttccttcatgg |
11313040 |
T |
 |
| Q |
301 |
ttccgagtagccatgaacataggagaccatcattggtgatccactttgaatagttcggatttggactcttttcactcgtggc |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11313041 |
ttccgagtagccatgaacataggagaccatcattggtgatccactttgaatagttcggatttggactcttttcacccgtggc |
11313122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University