View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7912_high_8 (Length: 346)
Name: NF7912_high_8
Description: NF7912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7912_high_8 |
 | |
|
| [»] scaffold0393 (2 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 84 - 181
Target Start/End: Original strand, 2409582 - 2409679
Alignment:
| Q |
84 |
accagattacatttcttatttggtaagaattttgagggagctactagaatagtggatcaaagaggtgttaagaagatttctggtgaccctagtggaag |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409582 |
accagattacatttcttatttggtaagaattttgagggagctactagaatagtggatcaaagaggtgttaagaagatttctggtgaccctagtggaag |
2409679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 264 - 329
Target Start/End: Original strand, 2409762 - 2409827
Alignment:
| Q |
264 |
attcaacatatgtggggtccatttcaattgaatagtttaaaactaggttaaatatcatatgatttt |
329 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2409762 |
attcaacatatttggggtccatttcaattgaatagtttaaaactaggttatatatcatatgatttt |
2409827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 84 - 181
Target Start/End: Original strand, 11905 - 12002
Alignment:
| Q |
84 |
accagattacatttcttatttggtaagaattttgagggagctactagaatagtggatcaaagaggtgttaagaagatttctggtgaccctagtggaag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |||||||| |
|
|
| T |
11905 |
accagattacatttcttatttggtaagaattttgagggagctactagaatagtggatcaaagaggtgttaagaggatttctggaaaccccagtggaag |
12002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 264 - 315
Target Start/End: Original strand, 12068 - 12119
Alignment:
| Q |
264 |
attcaacatatgtggggtccatttcaattgaatagtttaaaactaggttaaa |
315 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12068 |
attcaacagatttggggtccatttcaattgaatagtttaaaacttggttaaa |
12119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 116 - 162
Target Start/End: Complemental strand, 39961988 - 39961942
Alignment:
| Q |
116 |
tgagggagctactagaatagtggatcaaagaggtgttaagaagattt |
162 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
39961988 |
tgagggagctactagaatagtcgatcaaagaggtgttaagaggattt |
39961942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 321
Target Start/End: Complemental strand, 39961805 - 39961768
Alignment:
| Q |
284 |
atttcaattgaatagtttaaaactaggttaaatatcat |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39961805 |
atttcaattgaatagtttaaaactaggttaaagatcat |
39961768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University