View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7912_low_14 (Length: 306)
Name: NF7912_low_14
Description: NF7912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7912_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 76 - 258
Target Start/End: Original strand, 27049841 - 27050023
Alignment:
| Q |
76 |
cggcgaggttttagtgagagaaaaggggataatggttttgtgaagaagaaatgttgtggaggaggagtttgctaatgcgctcgtcgccatactcatccaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27049841 |
cggcgaggttttagtgagagaaaaggggataatggttttgtgaagaagaaatgttgtggaggaggagtttgctaatgcgctcgtcgccatactcatccaa |
27049940 |
T |
 |
| Q |
176 |
ttcatcatcattctcacttcattgcctcctcacacaccccaaatctctcaatttgcttaccacagttaattttgttaattata |
258 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27049941 |
ttcatcatccttctcacttcattgccttctcacacaccccaaatctctcaatttgcttaccacaattaattttgttaattata |
27050023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University