View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7912_low_18 (Length: 251)
Name: NF7912_low_18
Description: NF7912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7912_low_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] scaffold0393 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 15 - 251
Target Start/End: Original strand, 2409141 - 2409375
Alignment:
| Q |
15 |
ggcccgtatcacggatttgggtcgggttttccgaaccagttcacaaaatattatgttgcggttnnnnnnnnnnnnnntctgggaaagtgagaaatctaca |
114 |
Q |
| |
|
||||| |||||| |||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2409141 |
ggcccatatcacagatttgggtcgggttttctgacccagttcacaaaatattatgttgcggttaaaaaaaaaaaa--tctgggaaagtgagaaatctaca |
2409238 |
T |
 |
| Q |
115 |
ataaccaacgaatactagaaagtttgaaagtgagaatgagtgcaagtaatttggtagcagatcaagtgtggaagcaaattgaatctacacaaactggtat |
214 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409239 |
atcaccaacgaatactagaaagtttcgaagtgagaatgagtgcaagtaatttggtagcagatcaagtgtggaagcaaattgaatctacacaaactggtat |
2409338 |
T |
 |
| Q |
215 |
taatttgtgtaatgtgtatttatagcttaaattccaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409339 |
taatttgtgtaatgtgtatttatagcttaaattccaa |
2409375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0393 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: scaffold0393
Description:
Target: scaffold0393; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 93 - 214
Target Start/End: Original strand, 11546 - 11669
Alignment:
| Q |
93 |
ctgggaaagtgagaaatctacaa-ta-accaacgaatactagaaagtttgaaagtgagaatgagtgcaagtaatttggtagcagatcaagtgtggaagca |
190 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
11546 |
ctgggaaagtgagaaatctaaaaatacaccaacgaatactagaaagtttcaaagtgagaatgagtgcaagtaatttggtaacagatgaagtgtggaagca |
11645 |
T |
 |
| Q |
191 |
aattgaatctacacaaactggtat |
214 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
11646 |
aattgaatcaacacaaactggtat |
11669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 214
Target Start/End: Complemental strand, 39962156 - 39962076
Alignment:
| Q |
134 |
aagtttgaaagtgagaatgagtgcaagtaatttggtagcagatcaagtgtggaagcaaattgaatctacacaaactggtat |
214 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39962156 |
aagtttcaaagtgagcatgagtgcaagtaatttggcaacagatggagtgtggaagcaaattgaatctacacaaactagtat |
39962076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University