View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7913_high_9 (Length: 298)
Name: NF7913_high_9
Description: NF7913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7913_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 32 - 219
Target Start/End: Complemental strand, 20097836 - 20097641
Alignment:
| Q |
32 |
tcagaagactgctccctctttccccgccaagccgctcgcgtccattctatggaagctgcctccctcctgtaatcctcgtgaaactggcgacgagatggtg |
131 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
20097836 |
tcagaagactgctccctctttccccgcgaagtcgctcgtgtccattctatggaagttgcctccctcctgtaatcctcgtgaaaccggcgacgagagggtg |
20097737 |
T |
 |
| Q |
132 |
atcgttggcgtccgctattggccgacgcg--------ttcaaacccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct |
219 |
Q |
| |
|
||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20097736 |
atcgttgtcgtcctctattggccgacgcggaacacacttcaaacccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct |
20097641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 238 - 291
Target Start/End: Complemental strand, 20097644 - 20097591
Alignment:
| Q |
238 |
tccttccgccgtgccgtttgctctccctttgcctgtcctaatcactatcttcat |
291 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20097644 |
tccttctgccgtgctgtttgctctccctttgcttgtcctaatcactatcttcat |
20097591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University