View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7914_high_3 (Length: 295)
Name: NF7914_high_3
Description: NF7914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7914_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 25 - 281
Target Start/End: Complemental strand, 1329689 - 1329433
Alignment:
| Q |
25 |
ggctcttccaccacttcttcggctggttcctctggtggtggaagggccttgacttcattcatatcctcttccggttcaggttcgggttcgggttccttgg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329689 |
ggctcttccaccacttcttcggctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggttcgggttccttgg |
1329590 |
T |
 |
| Q |
125 |
cttcttcatccgaattgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329589 |
cttcttcatccgaattgttctcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctt |
1329490 |
T |
 |
| Q |
225 |
tggtgtgaccttatctatctcagggtactcagaagagcgacaaattccaatattctt |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329489 |
tggtgtgaccttatctatctcagggtactcagaagagcgacaaattccaatattctt |
1329433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University