View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7915_low_4 (Length: 256)
Name: NF7915_low_4
Description: NF7915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7915_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 53982773 - 53982997
Alignment:
| Q |
16 |
ataggtcagcctgtcacaattggattatgaggacctttaaatacactcatacattgatccgccgaggaatgatgctaaatgaatgaacacaacattagaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53982773 |
ataggtcagcctgtcacaattggattatgaggacctttaaatacactcatacattgatccgccgaggaatgatgctaaatgaatgaacacaacattagaa |
53982872 |
T |
 |
| Q |
116 |
attattaagtcattttaaaattatataaacatatcgttgtcaatgttattcatagaaagagtttcacttggattactcaaacaattaagaacgaaggact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53982873 |
attattaagtcattttaaaattatataaacatatcgttgtcaatgttattcatagaaagagtttcacttggattactcaaacaattaagaatgaaggact |
53982972 |
T |
 |
| Q |
216 |
ttgcgcacagttgtgagtttaaaat |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
53982973 |
ttgcgcacagttgtgagtttaaaat |
53982997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 99
Target Start/End: Original strand, 54000921 - 54000985
Alignment:
| Q |
35 |
ttggattatgaggacctttaaatacactcatacattgatccgccgaggaatgatgctaaatgaat |
99 |
Q |
| |
|
|||||| | |||||||||||||| |||||||||||||||| |||||||||| ||||| ||||||| |
|
|
| T |
54000921 |
ttggatcaagaggacctttaaatgcactcatacattgatctgccgaggaataatgctgaatgaat |
54000985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University