View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7916_low_3 (Length: 230)
Name: NF7916_low_3
Description: NF7916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7916_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 28254928 - 28254846
Alignment:
| Q |
5 |
tattgccaactaggaagtcctagatcaaggtacaggcaacatataaaccaggttaaatgcacatacaatcaacggttacatac |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28254928 |
tattgccaactaggaagtcctagatcaaggtacaggcaacatataaaccaggttaaatgcacatacaatcaacggttacatac |
28254846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 158 - 221
Target Start/End: Complemental strand, 28254775 - 28254712
Alignment:
| Q |
158 |
agttttgtaacattgtgttttaatattgactatattggatgtgcaaaatttgttcatctcactc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28254775 |
agttttgtaacattgtgttttaatattgactatattggatgtgcaaaatttgttcatttcactc |
28254712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University