View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7918_low_10 (Length: 224)
Name: NF7918_low_10
Description: NF7918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7918_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 206
Target Start/End: Complemental strand, 7457984 - 7457794
Alignment:
| Q |
16 |
attttctcactccctatccctaaccaacgagagacatctttttcatcagctctcactcaaatcaagtctagtctttgtttgttcttgtaagcaattatca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7457984 |
attttctcactccctatccctaaccaacgagagacatctttttcatcagctctcactcaaatcaagtctagtctttgtttgttcttgtaagcaattatca |
7457885 |
T |
|
| Q |
116 |
aaattagcttatcttttagggttccataaagagacaagggttgttggtgtttgcagatgatgacttttttctctttttaattctggtatct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7457884 |
aaattagcttatcttttagggttccataaagagacaagggttgttggtgtttgcagatgatgacttttttctctttttaattctggtatct |
7457794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 137
Target Start/End: Complemental strand, 7442704 - 7442585
Alignment:
| Q |
18 |
tttctcactccctatccctaaccaacgagagacatctttttcatcagctctcactcaaatcaagtctagtctttgtttgttcttgtaagcaattatcaaa |
117 |
Q |
| |
|
||||||| |||||| |||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
7442704 |
tttctcattccctaaccctaaccaatgagagacatctttttaatctgctctcactcaaatcaagtctagtctttctttcttcttgtaagcaatgatcaaa |
7442605 |
T |
|
| Q |
118 |
attagcttatcttttagggt |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
7442604 |
attagcttatcttttagggt |
7442585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 172
Target Start/End: Complemental strand, 7441984 - 7441943
Alignment:
| Q |
131 |
ttagggttccataaagagacaagggttgttggtgtttgcaga |
172 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
7441984 |
ttagggttccctaaagagaccagggttgttggtgtttgcaga |
7441943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University