View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7918_low_4 (Length: 311)
Name: NF7918_low_4
Description: NF7918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7918_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 16 - 299
Target Start/End: Original strand, 7389193 - 7389476
Alignment:
| Q |
16 |
attatactccctttatctcaaggagatatttgttgatttcacatatattaaaaattattaaagtattcatatataaaacatggtatatgtgaatttgatg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7389193 |
attatactccctttatctcaaggagatatttgttgatttcacatatattaaaaattattaaagtattcatatataaaacatggtatatgtgaatttgata |
7389292 |
T |
 |
| Q |
116 |
caaaataaatgtttgtgaaaattaatatgaatttggtgagacaataggaagtcacaaaaactttgtcatttctatatatggttgttttacacatcttcac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7389293 |
caaaataaatgtttgtgaaaattaatatgaatttggtgagacaataggaagtcacaaaaactttgtcatttctatatatggttgtattacacatcttcac |
7389392 |
T |
 |
| Q |
216 |
ggggtcgagaagaaaacgataggcatgcaaaagcacctcttttttaatttctaatattccatttttgcactacatgttcaaact |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7389393 |
ggggtcgagaagaaaacgataggcatgcaaaagcacctcttttttaatttctaatattccatttttgcactccatgttcaaact |
7389476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University