View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7918_low_8 (Length: 232)
Name: NF7918_low_8
Description: NF7918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7918_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 37225649 - 37225856
Alignment:
| Q |
15 |
atcttcttctttaagattaaagaaagcaaaaacttggtcaaccattttctccatgagactctttgatacagagtgattggttagtatgaagaaaccccac |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37225649 |
atcttcttctttaaggttaaagaaagcaaaaacttggtcaaccattttctccatgagactctttgatacagagtgattggttagtatgaagaatccccac |
37225748 |
T |
|
| Q |
115 |
tcctcacaagccttgcctatatcatggatggttttggtccgttgatcatgattactgttgatcaggagagaataatcaatgactgggattggatcattga |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37225749 |
tcctcacaagccttgcctatatcatggatggttttggtccgttgatcatgattaccgttgatcaggagagaataatcaatgactgggattggatcattga |
37225848 |
T |
|
| Q |
215 |
cttcatct |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
37225849 |
cttcatct |
37225856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University