View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7918_low_9 (Length: 230)
Name: NF7918_low_9
Description: NF7918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7918_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 144 - 187
Target Start/End: Complemental strand, 36159577 - 36159534
Alignment:
| Q |
144 |
cgatattggtttgacatcccattatataactttgtaatgttacc |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36159577 |
cgatattggtttgacatcccattatataactttgtaatgttacc |
36159534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 55
Target Start/End: Complemental strand, 36159701 - 36159666
Alignment:
| Q |
20 |
tccagaaatgccaaacagaagcttaaatgcaataga |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
36159701 |
tccagaaatgccaaacagaagcttaaatgcaataga |
36159666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 36153943 - 36153903
Alignment:
| Q |
15 |
tattctccagaaatgccaaacagaagcttaaatgcaataga |
55 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| |||| |
|
|
| T |
36153943 |
tattttccagaaatgccaaacagaaacttaaatgcattaga |
36153903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University