View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7919_low_4 (Length: 543)
Name: NF7919_low_4
Description: NF7919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7919_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 252
Target Start/End: Complemental strand, 23013306 - 23013074
Alignment:
| Q |
20 |
ttcagatgtttatgtttctaggaatcgtaatgctagagggcatatttatagttttgctaaatttatcaaagtttgtgatgacgataactgaataaagttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23013306 |
ttcagatgtttatgtttctaggaatcgtaatgctagagggcatatttatagttttgctaaatttatcaaagtttgtgatgacgataactgaataaagttc |
23013207 |
T |
 |
| Q |
120 |
ttaataatgtttatttttggggtcatcggttgtttgcgaatgtggcaaattttgataggtttaaataagtgtgatagaggttggtttcgtgacggcgagg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23013206 |
ttaataatgtttatttttggggtcatcggttgtttgcgaatgtggcaaattttgataggtttaaataagtgtgatagaggtaggtttcgtgacggcgagg |
23013107 |
T |
 |
| Q |
220 |
gagaaaaaatatttagagagggaaaaaagtggt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23013106 |
gagaaaaaatatttagagagggaaaaaagtggt |
23013074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University