View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7920_high_12 (Length: 407)
Name: NF7920_high_12
Description: NF7920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7920_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 19 - 394
Target Start/End: Complemental strand, 276897 - 276522
Alignment:
| Q |
19 |
tcttcacatttacgttatcaatatgccactgctcaaagcattgttcccaaacaatccaatccttttcctgccaaacaagggcacacctgcctctcaaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
276897 |
tcttcacatttacgttatcaatatgccactgctcaaagcattgttcccaaacaatccaatccttttcctgccaaacaagggcacacctgcctctcaaaag |
276798 |
T |
|
| Q |
119 |
gctttcgagtagaggaaagagatgtgcctccggctccatctgtctctattctgtttctagccctactcacgcctctgctctatctgtgtccgttgtgatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
276797 |
gctttcgagtagaggaaagagatgtgcctccggctccatctgtctctattctgtttctagccctactcacgcctctgctctatctgtgtccgttgtgatt |
276698 |
T |
|
| Q |
219 |
gttttgttgtttttcatcctacatgttctctgcagtcgtggcatccttcattcatagcctttaattactttatttctaaacactttcttgttattgacta |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
276697 |
gttttgttgtttttcatcctacatgttctctgcagtcgtggcatccttcattcatagccttcaattactttatttctaaacactttcttgttattgacta |
276598 |
T |
|
| Q |
319 |
gtgaatttagcttaagagtatgactctttcacagcctttaataaacnnnnnnnaaacccgagttcgaatcttgtct |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
276597 |
gtgaatttagcttaagagtatgactctttcatagcctttaataaactttttttaaaccggagttcgaatcttgtct |
276522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University