View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7920_high_29 (Length: 249)
Name: NF7920_high_29
Description: NF7920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7920_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 148 - 233
Target Start/End: Original strand, 26831618 - 26831700
Alignment:
| Q |
148 |
tttctgtatgcgatgttcctctactcaacaaataaagttttattatcggtccaaatggagggggttcagaccatgaaaattgatgt |
233 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26831618 |
tttctgtatgcgatgtttctctactcaacaaataaagttttat---cggtccaaatggagggggttcagaccatgaaaattgatgt |
26831700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 120
Target Start/End: Original strand, 8403274 - 8403312
Alignment:
| Q |
82 |
tattaaggtagttttgaggtgcgagaaagcaatttttga |
120 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
8403274 |
tattaaggtagttttgaggtgcgagagagtaatttttga |
8403312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University