View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7920_high_8 (Length: 460)
Name: NF7920_high_8
Description: NF7920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7920_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 344; Significance: 0; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 89 - 444
Target Start/End: Complemental strand, 41254551 - 41254196
Alignment:
| Q |
89 |
aaattagcaatatagttgttgtcattgttagagcacaaaccatgggatttccagtaggttacacggaacttctcttcccaaaattagttcttcacctttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41254551 |
aaattagcaatatagttgttgtcattgttagagcacaaaccatgggatttccagtaggttacacagaacttctcttcccaaaattagttcttcacctttt |
41254452 |
T |
 |
| Q |
189 |
atccatcttcactttcatacgaaaactcatcaacaccattttccgctacatgggtctccccgatttcatcgaacccgacattatatggcccgagaattca |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41254451 |
atccatcttcactttcatacgaaaactcatcaacaccattttccgctacatgggtctccccgatttcatcgaacccgacattatatggcccgaaaattca |
41254352 |
T |
 |
| Q |
289 |
actcgaatacccgaattcgaatccgtttcagctcttcttatccgtgaaatccttccagttgtaaaattcatggagctggtggacccacccgaaagctgcg |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41254351 |
actcgaatacccgaattcgaatccgtttcagctcttcttatccgtgaaatccttccagttgtaaaattcatggagctggtggacccacccgaaagctgcg |
41254252 |
T |
 |
| Q |
389 |
ctgtatgtcttactgagttcgagggaaacgatgagatcagacggttagcgaattgt |
444 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41254251 |
ctgtatgtcttactgagttcgaggaaaacgatgagatcagacggttagcgaattgt |
41254196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 55 - 92
Target Start/End: Complemental strand, 41254617 - 41254580
Alignment:
| Q |
55 |
acacaaaaattaacagaacacaacaaccatagttaaat |
92 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
41254617 |
acacaaaaattaagagaaaacaacaaccatagttaaat |
41254580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 14 - 42
Target Start/End: Complemental strand, 41254662 - 41254634
Alignment:
| Q |
14 |
atatataaaaggcaggccagtgttacaaa |
42 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41254662 |
atatataaaaggcaggccagtgttacaaa |
41254634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University