View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7920_low_25 (Length: 259)
Name: NF7920_low_25
Description: NF7920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7920_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 116 - 239
Target Start/End: Complemental strand, 21876377 - 21876254
Alignment:
| Q |
116 |
cgagaattcgttgaaaagtgatatatgttcaagtcatatcccacaaagacataggttcaactcatattattagcataataatctttttaacgagagttcg |
215 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21876377 |
cgagaattcgttgaaaagtgatataggttcaagtcatatcccacaaagacataggttcaactcatattattagcataataatctttttaacgagagtttg |
21876278 |
T |
|
| Q |
216 |
tcgaagctcttttgaagcataaag |
239 |
Q |
| |
|
|||||||| |||||| ||||||| |
|
|
| T |
21876277 |
tcgaagcttttttgagacataaag |
21876254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University