View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7920_low_30 (Length: 249)

Name: NF7920_low_30
Description: NF7920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7920_low_30
NF7920_low_30
[»] chr2 (1 HSPs)
chr2 (148-233)||(26831618-26831700)
[»] chr4 (1 HSPs)
chr4 (82-120)||(8403274-8403312)


Alignment Details
Target: chr2 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 148 - 233
Target Start/End: Original strand, 26831618 - 26831700
Alignment:
148 tttctgtatgcgatgttcctctactcaacaaataaagttttattatcggtccaaatggagggggttcagaccatgaaaattgatgt 233  Q
    ||||||||||||||||| |||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||    
26831618 tttctgtatgcgatgtttctctactcaacaaataaagttttat---cggtccaaatggagggggttcagaccatgaaaattgatgt 26831700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 120
Target Start/End: Original strand, 8403274 - 8403312
Alignment:
82 tattaaggtagttttgaggtgcgagaaagcaatttttga 120  Q
    |||||||||||||||||||||||||| || |||||||||    
8403274 tattaaggtagttttgaggtgcgagagagtaatttttga 8403312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University