View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7920_low_33 (Length: 225)
Name: NF7920_low_33
Description: NF7920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7920_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 35220875 - 35220667
Alignment:
| Q |
1 |
ttaaaatataaaagattgcaaatagatgcaggggaaaacatccacctcaaccaatgcaggttgtgaaacacccaatttttcacatgtttgcgtgtattgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
35220875 |
ttaaaatataaaagattgcaaatagatgcaggggaaaacatccacctcaaccaatgcaggttgtgtaacacccaattttttacatgtttgcgtgtattgt |
35220776 |
T |
|
| Q |
101 |
gaaggtgaaaaaacatgagaaaggggaatttgaattgtgtttgtcgttttttgagctctttaaaaacttacagttcagattactttcaatcctggttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||||| ||||| ||||| |
|
|
| T |
35220775 |
gaaggtgaaaaaacatgagaaaggag-atttgaattgtgtttgtcgctttttgagctctttaaaaactttcagtttggattactttcggtcctgattgca |
35220677 |
T |
|
| Q |
201 |
cttccaagat |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
35220676 |
cttccaagat |
35220667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University