View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7922_high_10 (Length: 209)
Name: NF7922_high_10
Description: NF7922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7922_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 43020450 - 43020277
Alignment:
| Q |
19 |
atgcagctatgacgatctacaagaagacaagaaaattggagtgtaagatatcaatggaagcttataagatattgcttatgcgtctttctaagtttggtaa |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43020450 |
atgcagctatgatgatctacaagaagacaagaaaattggagtgtaagatatcaatggaagcttataagatattgcttatgcgtctttctaagtttggtaa |
43020351 |
T |
 |
| Q |
119 |
atgtggatcattgttaagtgtctggcaggagatgcaagaatgtgggtatagttcagatgttgaagtttacgagt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43020350 |
atgtggatcattgttaagtgtctggcaggagatgcaagaatgtgggtatagttcagatgttgaagtttacgagt |
43020277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University