View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7922_high_11 (Length: 208)
Name: NF7922_high_11
Description: NF7922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7922_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 12 - 120
Target Start/End: Complemental strand, 43016603 - 43016495
Alignment:
| Q |
12 |
gaagaatatttaagaagactaaatcggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaat |
111 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43016603 |
gaagaatatttaagaagactaaattggaatggatgatgaataatacatacctgaaaattttcattttgttggagcatgattgttgaaacatggtaagaat |
43016504 |
T |
 |
| Q |
112 |
tgtcatcaa |
120 |
Q |
| |
|
||||||||| |
|
|
| T |
43016503 |
tgtcatcaa |
43016495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University