View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7922_low_8 (Length: 361)

Name: NF7922_low_8
Description: NF7922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7922_low_8
NF7922_low_8
[»] chr7 (1 HSPs)
chr7 (1-98)||(3225752-3225850)


Alignment Details
Target: chr7 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 3225850 - 3225752
Alignment:
1 acaccctaaaaaatgattaaacaggtcataacaataactttgtannnnnnn-gttgaagaaacaaaaactctatacgattaaattgcaacaataattca 98  Q
    ||||||||||||||||||||||||||||||||||||||| ||||        ||||||||||||||||||||||| |||||||||||||||||||||||    
3225850 acaccctaaaaaatgattaaacaggtcataacaataactctgtattttttttgttgaagaaacaaaaactctatatgattaaattgcaacaataattca 3225752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University