View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7923_high_11 (Length: 249)
Name: NF7923_high_11
Description: NF7923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7923_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 51393476 - 51393710
Alignment:
| Q |
1 |
gaaggaatcttgttaattatgtttaggaatttttatgcgtgtttgttaatttttaagctccatagtgtgaaaagagggttttggtttagatttttggtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51393476 |
gaaggaatcttgttaattatgtttaggaatttttatgcgtgtttgttaatttttaagctccatagtgtgaaaagagggctttggtttagatttttggtgg |
51393575 |
T |
|
| Q |
101 |
ttctagttgccaaatttgtgaaattgaagttcaattggacacaaagtgatgaaagaaaattgaagtgattgaaattgtgagatttctaaggaaaatttag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51393576 |
ttctagttgccaaatttgtgaaattgaagttcaattggacacaaagtgatgaaagaaaattgaagtgattgaaattgtgagatttctaaggaaaatttag |
51393675 |
T |
|
| Q |
201 |
aaattgggtagatcgaattattgtcttatgtttat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51393676 |
aaattgggtagatcgaattattgtcttatgtttat |
51393710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University