View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7923_low_5 (Length: 419)
Name: NF7923_low_5
Description: NF7923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7923_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 299; Significance: 1e-168; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 79 - 401
Target Start/End: Complemental strand, 5161351 - 5161029
Alignment:
| Q |
79 |
aataatgaaaattgattatggaagggtgaatataattagaacaataataatagaaacattgtatttacagggaataattggatcaggtttgtgttttgtg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5161351 |
aataatgaaaattgattatggaagggtgaatataattagaacaataataatagaaacattgtatttacagggaataattggatcaggtttgtgttttgtg |
5161252 |
T |
|
| Q |
179 |
ggaatgtcatggtgtgttaaaaagaggggtccagtctttacagcagcatttagcccatttgttcaaataatggcagccttgattgatatccctgtcctac |
278 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5161251 |
ggaatgtcatggtgtgttaagaagaggggtccagtctttacagcagcatttagcccatttgttcaaataatggcagccttgattgatatccctgtcctac |
5161152 |
T |
|
| Q |
279 |
atgagcagctctatcttggaaggtcagttccatttattttcttgttacttttccacccttttagatatgatatgatattaatataaaggtttttctaacc |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5161151 |
atgagcagctctatcttggaaggtcagttccatttattttcttgttactcttccacccttttagatatgatatgatattaatataagagtttttctaact |
5161052 |
T |
|
| Q |
379 |
tgtgcaacattgcatgtacatta |
401 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
5161051 |
tgtgcaacattgcatgcacatta |
5161029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 5161403 - 5161337
Alignment:
| Q |
1 |
atgtgtctaatagtattttctttttatgatttgagttattgtatttacagggaataatgaaaattga |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5161403 |
atgtgtctaatagtattttctttttatgatttgagttattgtatttacagggaataatgaaaattga |
5161337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 158 - 235
Target Start/End: Original strand, 14213012 - 14213089
Alignment:
| Q |
158 |
ggatcaggtttgtgttttgtgggaatgtcatggtgtgttaaaaagaggggtccagtctttacagcagcatttagccca |
235 |
Q |
| |
|
|||||||| ||||| | ||||| |||| |||||||||| ||| | | ||| ||||| |||||||||||||||| |||| |
|
|
| T |
14213012 |
ggatcaggcttgtgctatgtggcaatggcatggtgtgtcaaacaaaagggaccagtttttacagcagcatttacccca |
14213089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University