View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7923_low_9 (Length: 303)
Name: NF7923_low_9
Description: NF7923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7923_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 18 - 294
Target Start/End: Complemental strand, 49512190 - 49511921
Alignment:
| Q |
18 |
ataaggataacgacagtatcatcatcaaaattttccctccttaacctccatctccatgtaagtactcttactttacttattacgtgtctacatgaaaatt |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
49512190 |
ataaggataacgacaatatcatcatcaaaattttccctccttaacctccatctccatgtaagtactcttactt-----attacgt--ctacatgaaaatt |
49512098 |
T |
 |
| Q |
118 |
tcacttttgcattatttcatatatgtatgacacttgttttgattgcacaaagcaaggggaaaagaaacataaactatatataacgtcatgttgcacttac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49512097 |
tcacttttgcattatttcatatatgtatgacacttgttttgattgcacaaagcaagggtaaaagaaacataaactatatataacgtcatgttgcacttac |
49511998 |
T |
 |
| Q |
218 |
tacacgggaagctcgatgtgactatatatgaggtcgatacactacaaactcttgccggatgcaatttcgatctctgc |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49511997 |
tacacgggaagctcgatgtgactatatatgaggtcgatacactacaaactcttgccggatgcaatttcgatctctgc |
49511921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University