View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7924_high_4 (Length: 214)
Name: NF7924_high_4
Description: NF7924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7924_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 97 - 198
Target Start/End: Original strand, 27299634 - 27299735
Alignment:
| Q |
97 |
gggattcttgcaagtacctacatttttatatgaagacagtgccactgtggtacaagggattttggatgtacaattgatgagtttatacaataaataaata |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27299634 |
gggattcttgcaagtacctacatttttatatgaagacagtgccactgtggtacaagggattttggatgtacaattgatgagtttatacaataaataaata |
27299733 |
T |
|
| Q |
197 |
ct |
198 |
Q |
| |
|
|| |
|
|
| T |
27299734 |
ct |
27299735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 27299551 - 27299601
Alignment:
| Q |
14 |
gaatatttttaggcaactacatgtcaaaaatcttaattgttttgggttagt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27299551 |
gaatatttttaggcaactacatgtcaaaaatcttaattgttttgggttagt |
27299601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University