View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7924_low_5 (Length: 223)
Name: NF7924_low_5
Description: NF7924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7924_low_5 |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 82 - 159
Target Start/End: Original strand, 154087 - 154164
Alignment:
| Q |
82 |
attgatgaaatgtttgttgatggtataattcattgttgaatacttgaattgaatttgttattaaactcattattattg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
154087 |
attgatgaaatgtttgttgatggtataattcattgttgaatacttgaattgaatttgttattaaactcattattattg |
154164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University