View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7924_low_5 (Length: 223)

Name: NF7924_low_5
Description: NF7924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7924_low_5
NF7924_low_5
[»] scaffold0007 (1 HSPs)
scaffold0007 (82-159)||(154087-154164)


Alignment Details
Target: scaffold0007 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 82 - 159
Target Start/End: Original strand, 154087 - 154164
Alignment:
82 attgatgaaatgtttgttgatggtataattcattgttgaatacttgaattgaatttgttattaaactcattattattg 159  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
154087 attgatgaaatgtttgttgatggtataattcattgttgaatacttgaattgaatttgttattaaactcattattattg 154164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University