View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7926_high_16 (Length: 240)
Name: NF7926_high_16
Description: NF7926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7926_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 56 - 223
Target Start/End: Complemental strand, 12144591 - 12144424
Alignment:
| Q |
56 |
ttataacaagaacagttttgttatgttacatggacaatgttttgaacaagtgcaacaaaatggaatgtaactatttttcatgcagttgttggttgcagtt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12144591 |
ttataacaagaacagttttgttatgttacatggacaatgttttgaacaagtgcaacaaaatggaatgtaactatttttcatgcagttgttggttgcagtt |
12144492 |
T |
 |
| Q |
156 |
ataagcacttacaagtacgatggagatgagtttgatgagaatgtggctcattctgaagcaaccatatt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12144491 |
ataagcacttacaagtacgatggagatgaatttgatgagaatgtggctcattctgaagcaaccatatt |
12144424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 12144664 - 12144607
Alignment:
| Q |
1 |
ttgaagaagatgttgcctctctaactatcggtgatattcgcaaagtatgtgactctta |
58 |
Q |
| |
|
||||||||||||||||||||| ||| | ||||||||||||||||||||| |||||||| |
|
|
| T |
12144664 |
ttgaagaagatgttgcctctcaaaccaccggtgatattcgcaaagtatgcgactctta |
12144607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University