View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7926_low_21 (Length: 215)
Name: NF7926_low_21
Description: NF7926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7926_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 14 - 189
Target Start/End: Original strand, 25426797 - 25426972
Alignment:
| Q |
14 |
atcatagtattggtatgtaactatacaaatcaatcatagtctaattaaataaaaacaccttcactagagaataaccatcaacatcaatgcatcgataaat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
25426797 |
atcatagtattggtatgtaactatacaaatcaatcatagtctaattaaacaaaaacactttcactagagaataaccatcaacatcaatgcatcgatcaat |
25426896 |
T |
|
| Q |
114 |
ccacttaacacaacccacataattcaataagcaatgcaatcaaattaaaagaaaatgtaaatcaaatttattctta |
189 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||| |||| ||||| |
|
|
| T |
25426897 |
caacttaacacaacccacatacttcaataagcatgccaatcaaattaatggtaaatgtaaatcaattttactctta |
25426972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University