View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7927_low_16 (Length: 211)
Name: NF7927_low_16
Description: NF7927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7927_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 36 - 192
Target Start/End: Complemental strand, 54252239 - 54252083
Alignment:
| Q |
36 |
gtcaaatagcataaatagatgaataaatgaagaatttgaagtttgatcttaggctttatgtaaacgaaatagtgatcattattgtgtttgcttgatgatt |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54252239 |
gtcaaatagcataaatagatgaataaatgaagaatttgaagtttgaacttaggctctatgtaaacgaaatagtgatcattattgtgtttgcttgatgatt |
54252140 |
T |
 |
| Q |
136 |
tttggatttggtgaaattattggtattttagataattattccataattcagtttgtt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54252139 |
tttggatttggtgaaattattggtattttagataattattccataattcagtttgtt |
54252083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University