View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7927_low_8 (Length: 360)
Name: NF7927_low_8
Description: NF7927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7927_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 19 - 351
Target Start/End: Original strand, 54251743 - 54252075
Alignment:
| Q |
19 |
atagagtaaaagagacagatgtaaaggctgacaataaaaatgaaacggtaataaaacagtgtttggatgttgaagtgtctgtgtagtctgcacctcaaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
54251743 |
atagagtaaaagagacagatgtaaaggctgacaataaaaatgaaacggtaataaaacagtgtttggatgttgaagtgtctgtgtagtctgtacctcaaag |
54251842 |
T |
 |
| Q |
119 |
ggaccctccaaatttaaagcattactgactcaaatcctacaccattaggtgcatccctatttactgcaaaatattgtagaaacccaaagctcctcttctc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54251843 |
ggaccctccaaatttaaagcattactgactcaaatcctacaccattaggtgcatccctatttactgcaaaatattgtagaaacccaaagctcctcttctc |
54251942 |
T |
 |
| Q |
219 |
tccaacgaagaaaatgaaatgtctccttctttcccttttcttttccccctagaaatttggccttcaatccaagacaagacccaggcacaaaggtgaaaag |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54251943 |
tccaacgaagaaaatgaaatgtctccttctttcctttttcttttccccctagaaatctggccttcaatccaagacaagacccaggcacaaaggtgaaaag |
54252042 |
T |
 |
| Q |
319 |
tatttactaaaattaatcaatttttcttgacaa |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
54252043 |
tatttactaaaattaatcaatttttcttgacaa |
54252075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University