View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7929_low_10 (Length: 274)
Name: NF7929_low_10
Description: NF7929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7929_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 8 - 212
Target Start/End: Complemental strand, 46750810 - 46750606
Alignment:
| Q |
8 |
ttggtgttatagagctttcataatcgttaagcctgttgagaacgtgttggtgtttacgtacaaatatgtcactatcattttgtaaccttaccttcatggg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46750810 |
ttggtgttatagagctttcataatcgttaagcctgttgagaacgtgttggtgtttacgtacaaatatgtcactatcattttgtaaccttaccttcatggg |
46750711 |
T |
|
| Q |
108 |
ttccatgaattgagtctttcttattatgtggacgtgattgtgacagggcaggaccgattatctggcaagagaatttagtattatatggtccaaacatttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46750710 |
ttccatgaattgagtctttcttattatgtggacgtgattgtgacagggcaggaccgattatctggcaagagaatttagtattatatggtccaaacatttt |
46750611 |
T |
|
| Q |
208 |
ccgtt |
212 |
Q |
| |
|
||||| |
|
|
| T |
46750610 |
ccgtt |
46750606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University