View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7930_low_15 (Length: 205)
Name: NF7930_low_15
Description: NF7930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7930_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 31623183 - 31623358
Alignment:
| Q |
11 |
agcagagatggaaggtctccaaccccgttggatgaaaatcaacgttttactgagtgtgtttaaatgtgtaagttgtcaattttaaaggaaagttgcttca |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31623183 |
agcacagatggaaggtctccaaccccgttagatgaaaatcaacgttttaaagagtgtgtttaaatgtgtaagttgttaattttaaaggaaagttgcttca |
31623282 |
T |
 |
| Q |
111 |
aaagtgcatttttgtttatactacaaacaaatggcttgcgnnnnnnnntcacaaatgcatatcgttttagcatgaat |
187 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||| |||||||||||| |
|
|
| T |
31623283 |
aaagtgcatttttttttatactacaaacaaatggtttgcg-aaaaaaatcacaaatgcatatcggtttagcatgaat |
31623358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University