View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7930_low_9 (Length: 328)
Name: NF7930_low_9
Description: NF7930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7930_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 145 - 303
Target Start/End: Complemental strand, 26882918 - 26882760
Alignment:
| Q |
145 |
cttgtgatattcgtttgattcaaactaccagatcaactttgatgtattacagatttaaataatgacttaggcatcaacgttaaagtgaagacgtggatat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26882918 |
cttgtgatattcgtttgattcaaactaccagatcaactttgatgtattacagatttaaataatgacttaggcatcaacgttaaagtgaagacttggatat |
26882819 |
T |
 |
| Q |
245 |
tcaaatcactttgattttgtcacatttatagtcatcatggttttaagttattaattcag |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
26882818 |
tcaaatcactttgattttgtcacatttataggcatcatggttttatgttattaattcag |
26882760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 12 - 92
Target Start/End: Complemental strand, 26883055 - 26882974
Alignment:
| Q |
12 |
gaatatagtggttttggaatcatcttctccgtcannnnnnnn-ctatttgatctaaataagtggatttttacatagaagtga |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26883055 |
gaatatagtggttttggaatcatcttctccatcatttttttttctatttgatctaaataagtggatttttacatagaagtga |
26882974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University