View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7931_high_15 (Length: 263)
Name: NF7931_high_15
Description: NF7931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7931_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 24 - 251
Target Start/End: Complemental strand, 8695722 - 8695495
Alignment:
| Q |
24 |
attaactccattactatctatgttaaaagtaatatttatgctacatatattttgttgttgagtatttcgttggttggtaatggttaaataatttgaagat |
123 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8695722 |
attaactccattactatctatgttaacagtaatatttatgctacctatattttgttgttgagtatttcgttggttggtaatggttaaataatttgaagac |
8695623 |
T |
 |
| Q |
124 |
cgtgtgtttggtagcggggttttaggtggttatgagtggtaatccagtaaggccacattaatagaggatctaggtgaggtgacacattctaaaaagagca |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8695622 |
cgtgtgtttggtagcggggttttaggtggttatgagtggtaatctagtaaggccacattaatagaggatctaggtgaggtgacacattctaaaaagagca |
8695523 |
T |
 |
| Q |
224 |
tggttgtatatcacaaaagttgcatatt |
251 |
Q |
| |
|
||||||||||||| |||||||||||||| |
|
|
| T |
8695522 |
tggttgtatatcataaaagttgcatatt |
8695495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University