View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7931_low_11 (Length: 305)
Name: NF7931_low_11
Description: NF7931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7931_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 146 - 302
Target Start/End: Original strand, 35118019 - 35118175
Alignment:
| Q |
146 |
gcagaaatgtgatgtcagaaaaaggagggaagaaggagaagaagaaaatgaacgcgttattatcctctgtttttctctctttgtcaactttctctaatcg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35118019 |
gcagaaatgtgatgtcagaaaaaggagggaagaaggagaagaagaaaatgaacgcgttattatcctctgtttttctctctttgtcaactttctctaatcg |
35118118 |
T |
 |
| Q |
246 |
tgccacgtggcattcctttgctcnnnnnnnatccctcgtgttgagaataatataccc |
302 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
35118119 |
tgccacgtggcattcctttgctctttttttatccctcgtgttgagaccaatataccc |
35118175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 35117892 - 35117936
Alignment:
| Q |
18 |
acatcaatggctgtaacaggggtaaaatggggaattcagggtcagt |
63 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35117892 |
acatcaatggc-gtaacaggggtaaaatggggaattcagggtcagt |
35117936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University