View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7932_high_5 (Length: 525)
Name: NF7932_high_5
Description: NF7932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7932_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 1e-26; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 412 - 519
Target Start/End: Original strand, 2377301 - 2377410
Alignment:
| Q |
412 |
atcctacagtttggcactcattcgtgtgcaggata-tacaactttacctcttgcttagtgccgaaattacacaaacgcc-tccatgcacttcaccatatt |
509 |
Q |
| |
|
||||||||||||||||||||||||||||| || | | ||||||||||||| ||| ||||||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
2377301 |
atcctacagtttggcactcattcgtgtgctggctggtgcaactttacctctagctcagtgccgaaattacacaaacgccttccatgcatttcaccatatt |
2377400 |
T |
 |
| Q |
510 |
attggagatg |
519 |
Q |
| |
|
|||| ||||| |
|
|
| T |
2377401 |
attgcagatg |
2377410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 326 - 414
Target Start/End: Original strand, 2377195 - 2377280
Alignment:
| Q |
326 |
caaagggatttacattagctttgacaatgttggggggaaacatgcataaggaaacccttcttaacacgagaaaacgatgttgaagtatc |
414 |
Q |
| |
|
|||||| ||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
2377195 |
caaaggcattgacattaactttgacaatgttggggg--aacatgcataaggaaacccttcttaacaagagaaaacg-tgttgaagtatc |
2377280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 181 - 221
Target Start/End: Original strand, 2376357 - 2376397
Alignment:
| Q |
181 |
tggattatttctccttaaatactacctttataactaatttt |
221 |
Q |
| |
|
|||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
2376357 |
tggattatttttcccttaatactacctttataactaatttt |
2376397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 326 - 412
Target Start/End: Complemental strand, 1522829 - 1522745
Alignment:
| Q |
326 |
caaagggatttacattagctttgacaatgttggggggaaacatgcataaggaaacccttcttaacacgagaaaacgatgttgaagta |
412 |
Q |
| |
|
|||||| ||| |||||| |||||||||||||||||| ||||||||||||||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
1522829 |
caaaggcattgacattaactttgacaatgttggggg--aacatgcataaggaaacccttattaacacgagaaaatgttgttgaagta |
1522745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 277 - 336
Target Start/End: Complemental strand, 1523785 - 1523727
Alignment:
| Q |
277 |
tgtctgttgaaaggacttcctttgctccctaggtcattcttggaagcttcaaagggattt |
336 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1523785 |
tgtctgttgaaaggacttcctt-gctccctaggtcattcttggaagcttcaaagggattt |
1523727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 421 - 490
Target Start/End: Original strand, 35726310 - 35726380
Alignment:
| Q |
421 |
tttggcactcattcgtgtgcaggat-atacaactttacctcttgcttagtgccgaaattacacaaacgcct |
490 |
Q |
| |
|
|||||||||||||||| |||||| | || ||||||||||||||||| || ||||||| ||||||||||||| |
|
|
| T |
35726310 |
tttggcactcattcgtatgcaggctgatgcaactttacctcttgctcagcgccgaaactacacaaacgcct |
35726380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University