View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7932_low_6 (Length: 406)
Name: NF7932_low_6
Description: NF7932
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7932_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 2e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 35 - 304
Target Start/End: Complemental strand, 6325056 - 6324794
Alignment:
| Q |
35 |
aattttgtgcagcttgttgattgtgttgctcccatttatactgagttaaatagtcccttgca-cagaagcaacttttttaggattcaacaatgatccttc |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||| || |||||||| |||||| ||||||||||||| |||||| |||| ||||||||| |||||||||||||| |
|
|
| T |
6325056 |
aattttgtgcagcttgttgattgtattgcgcctatttataccgagttacatagtcccttgcatcagaaggaactcttttaggatctaacaatgatccttc |
6324957 |
T |
|
| Q |
134 |
ccaaagacatttgtttctacatttccaaatgctccataaacaagtagctagcaaatctgtgactgtatcttctctcagacagtgctgctgcataaatcaa |
233 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
6324956 |
ccaaaggcatttgtttctacacttccaaatgctccataaacaagtagctagcaaat------ctgcatct--tctcagacagtgctgctgcataaatcaa |
6324865 |
T |
|
| Q |
234 |
agagcatttcagtgagattgagggcttggttgctgatctgttagatacttggccataatttcagctcttgc |
304 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
6324864 |
agagcatttcagtgagactgagggcttggttgctgatctgttggatactaggccataatttcagctcttgc |
6324794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University