View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7933_high_15 (Length: 228)
Name: NF7933_high_15
Description: NF7933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7933_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 37 - 159
Target Start/End: Original strand, 33119832 - 33119953
Alignment:
| Q |
37 |
gtcaagtctttttctatactgttttattcacacaaaagtgaactatttctatactgttcccattattatgaaacgtgtttctggaacattgcagaaattt |
136 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33119832 |
gtcaagtctttt-ctatactgttttattcacacaaaagagaactttttctatactgttcccattattatgaaacgtgtttctggaagattgcagaaattt |
33119930 |
T |
 |
| Q |
137 |
agattaaacacaacacaaggcac |
159 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33119931 |
agattaaacacaacacaaggcac |
33119953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University