View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7933_low_11 (Length: 251)
Name: NF7933_low_11
Description: NF7933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7933_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 33120088 - 33120321
Alignment:
| Q |
1 |
tttatgaagttcgattataataagtaagcatgtataaaaagatctttattatcaaacacaaaacnnnnnnngga-gatctgtaaacaaaaccacaaagtt |
99 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| |||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
33120088 |
tttatgtagttcgattataataaggaagcatgcataaaaagatctgtattatcaaacacaaaacaaaaaaaggaagatctgtaaacaaaaccacaaagtt |
33120187 |
T |
|
| Q |
100 |
ttgtactcatttttctaataattttttataatagaaaatacaacaaatttgttatatttagtaacaaagaaaatatacgaaccgtagtcttggtagcacc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33120188 |
ttgtactcatttttctaataattttttataatagaaaatacaacaaatttgttatat---gtaacaaagaaaatatacgaaccgtagtcttggtagcacc |
33120284 |
T |
|
| Q |
200 |
atcataaagcaactgaggaacacccttgggaaaaatc |
236 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33120285 |
atcataaagcaactgaggaacatccttgggaaaaatc |
33120321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University