View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7933_low_12 (Length: 246)
Name: NF7933_low_12
Description: NF7933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7933_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 172
Target Start/End: Original strand, 4839747 - 4839918
Alignment:
| Q |
1 |
gcctaattaaatcgaataacaacaatcatatttgttccattctcaatgttgatgggagctgcaacggggttccaatccgagcaagttttggtggtgtact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4839747 |
gcctaattaaatcgaataacaacaatcatatttgttccatactcaatgttgatgggagctgcaaccgggttccaatccgagcaagttttggtggtgtact |
4839846 |
T |
|
| Q |
101 |
tcgtaatagtgcagacatgtatctcacaggattttcaggtttcatccctcattcaaatgacatattgcaagc |
172 |
Q |
| |
|
||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4839847 |
tcgcaatagtgtagacatgtatctcacaggattttcaggtttcatccctcattcaaatgacatattgcaagc |
4839918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University