View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7933_low_14 (Length: 232)
Name: NF7933_low_14
Description: NF7933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7933_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 3262198 - 3262001
Alignment:
| Q |
13 |
atgaagaagaaaaagaaatgtatatcatgaaagttctgtcttacattgatcttttgaaatgaacaagtgaagcggaaattcatttgaannnnnnnnctct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3262198 |
atgaagaagaaaaagaaatgtatatcatgaaagttctgtcttacattgatcttttgaaatgaacaagtgaagcggaaattcatttgaatttttttt-tct |
3262100 |
T |
|
| Q |
113 |
caccataaatgttaaaaattgtgaaaacttataatctaagtttattggttcaaatgcatgagtggatgctacaaattttccttttacatattttctcat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3262099 |
caccataaatgttaaaaattgtgaaaacttataatctaagtttattggttcaaatgcatgagtggatgctacaaattttccttttacatattttctcat |
3262001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University