View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7933_low_7 (Length: 303)
Name: NF7933_low_7
Description: NF7933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7933_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 40 - 298
Target Start/End: Complemental strand, 49621353 - 49621100
Alignment:
| Q |
40 |
ataagaaaccttttgacaattgtctttattctcttctctaccttcaaaataaacacaataaacatacaatttagacctctaactacccttccatgtgagt |
139 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49621353 |
ataagaaaccttttgagaattgtctttattctct-----accttcaaaataaacacaataaacatacaatttagacctctaactacccttccatgtgagt |
49621259 |
T |
|
| Q |
140 |
gatactcaatcatgaatctcgttaaataaaataaaatatcatacatatataaagtccgtacgtaagaaaccaaaattaatcccacgaagactagtattct |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49621258 |
gatactcaatcatgaatctcgttaaataaaataaaatatcatacatatataaagtccgtacgtaagaaaccaaaattaatcccacgaagactagtattct |
49621159 |
T |
|
| Q |
240 |
taaaacaaacacagtttcacattgcttgcttgacatactcaaacgcctgtatcatgtct |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49621158 |
taaaacaaacacagtttcacattgcttgcttgacatactcaaacgcctgtatcatgtct |
49621100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University