View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7934_low_5 (Length: 430)
Name: NF7934_low_5
Description: NF7934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7934_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 7e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 36272015 - 36271828
Alignment:
| Q |
1 |
ttaattcgtagaagggg--ctaaaacaagaacactggcgtctggtgctattaccactttttcacttcgtagttgaagtgatctttcttggaacatcaaca |
98 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36272015 |
ttaattcgtagaaggggggctaaaacaagaacactggcgtctggtgctattaccactttttcacttcgtagttgaagtgatctttcttgtaacatcaaca |
36271916 |
T |
|
| Q |
99 |
atggcgtacttgagcatgggtgaagctcacagaagaatcaccgaatacctcaaccgtttctccgacgctgtttcataccaaaacggca |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36271915 |
atggcgtacttgagcatgggtgaagctcacagaagaatcaccgaatacctcaaccgtttctccgacgctgtttcataccaaaacggca |
36271828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 261 - 414
Target Start/End: Complemental strand, 36271753 - 36271600
Alignment:
| Q |
261 |
gtcaacgatttcaatcgactcatcaaccaaaacgataactactctcacttctcagatatcatctctcctctttttcgatcacttcaacactataaacaat |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
36271753 |
gtcaacgatttcaatcgactcatcaaccaaaacgataactactctcacttctcagatatcatctctcctctttttcgatcacttcaacactataaacagt |
36271654 |
T |
|
| Q |
361 |
ccaatttcgttgaagcctataacgctttcgaaaaaaccgctaagtataattcat |
414 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36271653 |
ccaatttcgttgaagcctataacgctttcgaaaaaaccgctaagtataattcat |
36271600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University